Package Health Score

49 / 100

security
No known security issues
popularity
Limited
maintenance
Inactive
community
Sustainable

Popularity

Limited

GitHub Stars: 365
Forks: 37
Contributors: 1

Direct Usage Popularity

Based on project statistics from the GitHub repository for the PyPI package multiPrime, we found that it has been starred 365 times.

Security

No known security issues

Security and license risk for latest version

Release Date: Nov 2, 2023
Direct Vulnerabilities: 0
C
0
H
0
M
0
L
Indirect Vulnerabilities: 0
C
0
H
0
M
0
L
License Risk: 0
H
0
M
0
L

All security vulnerabilities belong to production dependencies of direct and indirect packages.

License

MIT

Security Policy

We found a way for you to contribute to the project! Looks like multiPrime is missing a security policy.

You can connect your project's repository to Snyk to stay up to date on security alerts and receive automatic fix pull requests.

Keep your project free of vulnerabilities with Snyk

Maintenance

Inactive

Commit Frequency

Open Issues: 17
Open PR: 0
Last Release: 1 year ago
Last Commit: 4 months ago

Further analysis of the maintenance status of multiPrime based on released PyPI versions cadence, the repository activity, and other data points determined that its maintenance is Inactive.

An important project maintenance signal to consider for multiPrime is that it hasn't seen any new versions released to PyPI in the past 12 months, and could be considered as a discontinued project, or that which receives low attention from its maintainers.

As a healthy sign for on-going project maintenance, we found that the GitHub repository had at least 1 pull request or issue interacted with by the community.

Community

Sustainable

Readme: Yes
Contributing.md: No
Code of Conduct: No
Contributors: 1
Funding: No

This project has seen only 10 or less contributors.

We found a way for you to contribute to the project! Looks like multiPrime is missing a Code of Conduct.

Embed Package Health Score Badge

Keep your project healthy

Check your requirements.txt

Ensure all the packages you're using are healthy and well-maintained

Snyk Vulnerability Scanner

Get health score & security insights directly in your IDE

Package

Python Versions Compatibility: >=3.6

Age: 2 years
Latest Release: 1 year ago
Dependencies: N/A
Versions: 21
Maintainers: 1
Wheels: No

Readme

multiPrime

multiPrime (version=2.4.7) is an error-tolerant primer design tool for broad-spectrum pathogens detection. It proposes a solution for the maximal coverage degenerate primer design with error (MD-EDPD). pipeline links: https://github.com/joybio/multiPrime.

1. Install

> pip

pip3 install multiPrime

pip python >=3.9

2. Usage

$ multiPrime -h

Parameters：

Parameters	Description
DPrime	Degenerate primer design through MD-EDPD or MD-DPD.
Ppair	Primer pair selection from the result of multiPrime DPrime.
Perfect	Extract primer-contained sequences with non-mismatches.
Errors	Extract primer-contained sequences with errors.

multiPrime DPrime -i input -o output
           Options: { -l [18] -n [4] -d [10] -v [1] -g [0.2,0.7] -f [0.8] -c [4] -p [10] -a [4] }

Parameters：

Parameters	Description
-i/--input	Input file: Result of multi-alignment. (muscle, mafft or others)
-l/--plen	Length of primer. Default: 18
-n/--dnum	Number of degenerate. Default: 4.
-v/--variation	Max mismatch number of primer. Default: 1.
-e/--entropy	Entropy is actually a measure of disorder. This parameter is used to judge whether the window is conservation. Entropy of primer-length window. Default: 3.6.
-g/--gc	Filter primers by GC content. Default [0.2,0.7].
-s/--size	Number of degenerate. Default: 4.
-f/--fraction	Filter primers by match fraction (Coverage with errors). Default: 0.8.
-c/--coordinate	Mismatch index is not allowed to locate in your specific positions. otherwise, it won't be regard as the mis-coverage. With this param, you can control the index of Y-distance (number=variation and position of mismatch). when calculate coverage with error. coordinate>0: 5'==>3'; coordinate<0: 3'==>5'. You can set this param to any value that you prefer. Default: 1,-1. 1: I dont want mismatch at the 2nd position, start from 0. -1: I dont want mismatch at the -1st position, start from -1.
-p/--proc	Number of process to launch. Default: 20.
-a/--away	Filter hairpin structure, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT. Primers should not have complementary sequences (no consecutive 4 bp complementarities),otherwise the primers themselves will fold into hairpin structure.
-o/--out	Output file: candidate primers. e.g. [*].candidate.primers.out.

multiPrime Ppair -i input -r reference -o output
           Options: {-f [0.6] -m [500] -n [200] -e [4] -p [9] -s [250,500] -g [0.4,0.6] -d [4] -a ","}

Parameters：

Parameters	Description
-i/--input	Input file: output of multiPrime DPrime.
-r/--ref	Reference sequence file: all the sequence in 1 fasta, for example: (Cluster_96_171.tfa).
-g/--gc	Filter primers by GC content. Default [0.2,0.7].
-f/--fraction	Filter primers by match fraction. Default: 0.6. Sometimes you need a small fraction to get output.
-e/--end	Filter primers by degenerate base position. e.g. [-e 4] means I dont want degenerate base appear at the end four bases when primer pre-filter. Default: 4.
-s/--size	Filter primers by PRODUCT size. Default [250,500].
-d/--dist	Filter param of hairpin, which means distance of the minimal paired bases. Default: 4. Example:(number of X) AGCT[XXXX]AGCT.
-t/--tm	Difference of Tm between primer-F and primer-R. Default: 5.
-p/--proc	Number of process to launch. Default: 20.
-a/--adaptor	Adaptor sequence, which is used for NGS next. Hairpin or dimer detection for [adaptor--primer]. example: TCTTTCCCTACACGACGCTCTTCCGATCT,TCTTTCCCTACACGACGCTCTTCCGATCT (Default). If you dont want adaptor, use [","]
-m/--maxseq	Limit of sequence number. Default: 0. If 0, then all sequence will take into account. This param should consistent with [max_seq] in multi-alignment.
-o/--out	Output file: candidate primer pairs. e.g. [*].candidate.primers.txt.

multiPrime Perfect -i [input] -p [10] -f [format] -o [output] -s [Coverage.xls]

Parameters：

Parameters	Description
-i/--input	Input file: Primer file. One of the followed three types: final_maxprimers_set.xls (see output of multiPrime in github (https://github.com/joybio/multiPrime)); primer.fa (primer fasta) or primer_F,primer_R.
-r/--ref	Sequence file: all the input sequences in 1 fasta.
-f/--format	Format of primer file: xls or fa or seq; default: xls, indicate final_maxprimers_set.xls. xls: final_primer_set.xls; fa:fasta format or seq: sequence format, comma seperate. e.g. primer_F,Primer_R.
-p/--process	Number of process to launch. Default: 20.
-o/--out	Output_dir. default: PCR_product.
-s/--stast	Stast information: number of coverage and total. Default: Coverage.xls.

multiPrime Errors -i [input] -r [bowtie index] -l [150,2000] -p [10]-o [output]

Parameters：

Parameters	Description
-i/--input	input file: primer.fa.
-r/--ref	reference file: the fasta of raw input.
-l/--len	Length of primer, which is used for mapping. If the length of the primer used for mapping is set to 0, the entire length of the primer will be utilized. Default: 0
-d/--dict	It is used to extract non-coverd sequences and can be obtained from prepare_fa_pickle.py (https://github.com/joybio/multiPrime). Dictionary of targets sequences, binary format. Default: None
-t/--term	Position of mismatch is not allowed in the 3 term of primer. Default: 4
-b/--bowtie	bowtie/ABS_path(bowtie) or bowtie2/ABS_path(bowtie2) was employed for mapping. Default: bowtie2
-m/--seedmms	Bowtie: Mismatches in seed (can be 0 - 3, default: -n 1).Bowtie2: Gap or mismatches in seed (can be 0 - 1, default: -n 1).
-p/--process	Number of process to launch. Default: 20.
-o/--out	Output file: PCR product with primers.

3. Results

multiPrime DPrime

output：Information of primer.
output.gap_seq_id_json: Positions and non-contained sequences caused by errors (number of errors are greater than threshold).
output.non_coverage_seq_id_json: Positions and non-contained sequences.

multiPrime Ppair

output：*.candidate.primers.txt

multiPrime Perfect

output：PCR_product
Coverage.xls：Total coverage for all primers.

multiPrime Errors

output：PCR product with primer pairs.
output.pair.num：Target amplicon number with primer pairs.
others：Temp files.
unmatched.fa: the sequences that were not captured by the core primer set with setting mismatches.

4. test dir

multiPrime/example

5. Contact

Please send comments, suggestions, bug reports and bug fixes to 1806389316@pku.edu.cn

FAQs

What is multiPrime?

. Visit Snyk Advisor to see a full health score report for multiPrime, including popularity, security, maintenance & community analysis.

Is multiPrime popular?

The python package multiPrime receives a total of 93 weekly downloads. As such, multiPrime popularity was classified as limited. Visit the popularity section on Snyk Advisor to see the full health analysis.

Is multiPrime well maintained?

We found indications that multiPrime is an Inactive project. See the full package health analysis to learn more about the package maintenance status.

Is multiPrime safe to use?

The python package multiPrime was scanned for known vulnerabilities and missing license, and no issues were found. Thus the package was deemed as safe to use. See the full health analysis review.

Last updated on 28 November-2024, at 18:56 (UTC).

Build a secure application checklist

Select a recommended open source package

Minimize your risk by selecting secure & well maintained open source packages

DONE

Scan your app for vulnerabilities

Scan your application to find vulnerabilities in your: source code, open source dependencies, containers and configuration files

SCAN NOW

Fix identified vulnerabilities

Easily fix your code by leveraging automatically generated PRs

AUTO FIX

Monitor for new issues

New vulnerabilities are discovered every day. Get notified if your application is affected

MONITOR APP

multiPrime

For more information about how to use this package see README

Ensure you're using the healthiest python packages

Package Health Score

Popularity

Direct Usage Popularity

Security

Security and license risk for latest version

Maintenance

Commit Frequency

Community

Embed Package Health Score Badge

Keep your project healthy

Check your requirements.txt

Snyk Vulnerability Scanner

Package

Readme

multiPrime

1. Install

2. Usage

3. Results

4. test dir

5. Contact

FAQs

What is multiPrime?

Is multiPrime popular?

Is multiPrime well maintained?

Is multiPrime safe to use?

Build a secure application checklist

Select a recommended open source package

Scan your app for vulnerabilities

Fix identified vulnerabilities

Monitor for new issues

Package Health Score

Direct Usage Popularity

Security and license risk for latest version

Commit Frequency

Embed Package Health Score Badge

Keep your project healthy

Check your requirements.txt

Snyk Vulnerability Scanner

Readme

multiPrime

1. Install

2. Usage

3. Results

4. test dir

5. Contact

FAQs

What is multiPrime?

Is multiPrime popular?

Is multiPrime well maintained?

Is multiPrime safe to use?

Build a secure application checklist

Select a recommended open source package

Scan your app for vulnerabilities

Source Code

Open Source

Container

Config

Fix identified vulnerabilities

Monitor for new issues